Θέματα & Απαντήσεις στη Βιολογία Γενικής Παιδείας 2016- Παλαιό Σύστημα Πανελλαδικές εξετάσεις

Δείτε τα θέματα και τις απαντήσεις στη Βιολογία Γενικής Παιδείας 2016 : 

Καλή επιτυχία!

Εύχομαι επιτυχία σε όλους τους υποψήφιους των Πανελλαδικών εξετάσεων! 
Συγχαρητήρια για όλη την προσπάθεια που κατέβαλαν 
σε όλη τη διάρκεια της χρονιάς
προκειμένου να πραγματοποιήσουν ένα από τα όνειρα τους! 
Picture: Good Luck

Καλό Πάσχα!

Καλό διάβασμα με δύναμη και επιμονή 
στους υποψήφιους μαθητές των Πανελληνίων εξετάσεων! 

Άσκηση με χαρτογράφηση γονιδίων

Για την χαρτογράφηση γονιδίων που είναι υπεύθυνα για κληρονομικές ασθένειες, συντίθενται ειδικοί ανιχνευτές σημασμένοι με φθορίζουσες ουσίες. Οι ανιχνευτές υβριδοποιούν τις συγκεκριμένες γενετικές θέσεις σε μεταφασικά χρωμοσώματα διπλοειδών σωματικών κυττάρων, τα οποία αρχικά έχουμε αποδιατάξει. Με βάση τις υβριδοποιήσεις βρίσκουμε τη θέση των γονιδίων στα χρωμοσώματα.

Ποια η θέση των γονιδίων (Α και Β) στα χρωμοσώματα για δύο αυτοσωμικές υπολειπόμενες κληρονομικές ασθένειες αντίστοιχα, με βάση τον παρακάτω πίνακα που απεικονίζει τους υβριδισμούς των ανιχνευτών των παραπάνω συγκεκριμένων γενετικών θέσεων σε μεταφασικά χρωμοσώματα σωματικών κυττάρων τεσσάρων ατόμων:


Βασιλική

Κώστας
Κατερίνα
Γιώργος
Φαινότυπος  (Χρωμοσωμική σύσταση)
Φυσιολογική
Tρισωμία 13
Σύνδρομο Turner
Σύνδρομο Klinefelter
Yβριδοποιήσεις του Α γονιδίου
4
2
2
4
Yβριδοποιήσεις του Β γονιδίου
4
6
4
4




Μετάλλαξη και πλαίσιο ανάγνωσης

Δίνονται τα παρακάτω γενεαλογικά δένδρα που αναπαριστούν την κληρονόμηση δύο μονογονιδιακών ασθενειών Α και Β της ίδιας οικογένειας:
-Με ποιον τρόπο κληρονομείται η κάθε ασθένεια;

-Ποια η πιθανότητα να γεννηθεί κόρη με  την ασθένεια Α και ποια η πιθανότητα να γεννηθεί γιος και με τις δύο ασθένειες;
-Παρακάτω φαίνεται η κωδική αλυσίδα του φυσιολογικού και του μεταλλαγμένου γονιδίου της ασθένειας Α αντίστοιχα:

Mετά τη μετάλλαξη προκλήθηκε πρόωρος τερματισμός της μετάφρασης. Αφού γράψετε τους προσανατολισμούς στα παραπάνω γονίδια να βρείτε:
  • Το είδος της γονιδιακής μετάλλαξης
  • Τα κωδικόνια του φυσιολογικού γονιδίου
  • Τις 5’-3’ αμετάφραστες περιοχές του m RNA
  • Το τμήμα του m RNA που θα προσδεθεί η μικρή υπομονάδα του ριβοσώματος

Η περιοριστική ενδονουκλεάση ΗaeIII κόβει στην παρακάτω αλληλουχία μεταξύ G και C.
 5΄GGCC3΄ 
3΄CCGG5΄
-Είναι κατάλληλη η ΗaeIII να χρησιμοποιηθεί για την κλωνοποίηση του φυσιολογικού γονιδίου σε γονιδιωματική βιβλιοθήκη;
-Αναφέρετε δύο άλλους εναλλακτικούς τρόπους κλωνοποίησης του φυσιολογικού γονιδίου και τα πλεονεκτήματα του καθενός.



Άσκηση με οπερόνιο λακτόζης

Το παρακάτω διάγραμμα δείχνει τις μεταβολές στη συγκέντρωση της γλυκόζης (καμπύλη Β), της ανάπτυξης του βακτηρίου E.coli (καμπύλη Α) και τη συγκέντρωση ενός εκ των ενζύμων διάσπασης της λακτόζης (περμεάση -καμπύλη Γ):
Καμπύλη Α: ανάπτυξη βακτηρίου E. coli
Καμπύλη Β: γλυκόζη
Καμπύλη Γ: περμεάση
Στο θρεπτικό υλικό προσθέσαμε αρχικά (t=0΄)γλυκόζη και λακτόζη.


Aπαντήστε στις ερωτήσεις:
Aν τα παρακάτω mRNA αποτελούν προϊόντα μεταγραφής του οπερονίου της λακτόζης, ποια χρονικά διαστήματα από το t=0 έως t=200 min, απομονώσαμε από το βακτήριο, το καθένα από τα παρακάτω m RNA:

i) 3΄ AAAAGUGGGGAGCGCGAAAGAGUAAAAA

ii)3΄AAGUGGGGAGGUAAAGUGGAGACGCCAGCGUAAAAAGUGGAGCGGUAAAAA5΄


Αιτιολογήστε την απάντησή σας

Άσκηση με PCR

Μία κληρονομική πάθηση οφείλεται σε δυσλειτουργία δύο κυτταρικών τύπων ενός οργανισμού. Στον πρώτο κυτταρικό τύπο δεν παράγεται μια ουσία λόγω μετάλλαξης ενός γονιδίου που εδράζεται στο χρωμόσωμα 5, ενώ στον δεύτερο δεν παράγεται ή παράγεται μη λειτουργικό, ένζυμο που κωδικοποιείται από γονίδιο που εδράζεται στο χρωμόσωμα 8. Για την διάγνωση της νόσου σε άτομο, γίνεται σε χρωμοσωμικό DNA, μοριακή ανάλυση μέσω τεχνικής PCR. Παρακάτω δίνονται τα δύο προαναφερθέντα γονίδια με έντονα μεγάλα γράμματα
Ποιες από τις παρακάτω ολιγονουκλεοτιδικές αλυσίδες, που θα παίξουν τον ρόλο των πρωταρχικών τμημάτων RNA (εκκινητές), θα χρησιμοποιούσατε για την απομόνωση και in vitro αντιγραφή (PCR) των δύο γονιδίων από τα χρωμοσώματα 5 και 8: 

Για το γονίδιο του χρωμοσώματος 5


Για το γονίδιο του χρωμοσώματος 8:
i)
CATACTGTT
i)
5΄ CCCCGT 3
ii)
GCCAATTTT
ii)
5 ΄GGGGTCATT 3΄
iii)
AACAGTATG 3
iii)
5΄ GCCCATGCG 3΄
iv)
5΄ΑΑΑΑTTGGC
iv)
CTTTTT

Συνδυαστική άσκηση κεφάλαια 1-2-5-6


A)Αρσενικό άτομο ενός διπλοειδούς είδους Μ έχει καρυότυπο 26(ΑΑ) Α18Α18Α18 ΧΥ. Το γράμμα Α αντιστοιχεί στα αυτοσωμικά χρωμοσώματα. Αν θεωρήσουμε ότι ο φυλοκαθορισμός γίνεται όπως και στον άνθρωπο, ονομάστε το είδος της γενετικής ασθένειας.
Πόσα μόρια DNA υπάρχουν στον παραπάνω καρυότυπο του ατόμου, πόσα σε ένα πιθανό σπερματοζωάριο αυτού του ατόμου και πόσα σε ένα σπερματοζωάριο φυσιολογικού ατόμου του ίδιου είδους;

Β) Πάνω στο 18ο χρωμόσωμα του παραπάνω οργανισμού εδράζεται γονίδιο που ελέγχει ένα χαρακτήρα (χαρακτήρας Ζ). Στη διάρκεια της εξέλιξης του είδους το γονίδιο αυτό έχει μεταλλαχθεί δύο φορές με διαφορετικό τρόπο (μεταλλαγμένο γονίδιο Ζ1- μεταλλαγμένο γονίδιο Ζ2), δίνοντας δύο διαφορετικές παραλλαγές του χαρακτήρα Ζ. Το μεταλλαγμένο γονίδιο Ζ1 δίνει τον χαρακτήρα Ζ1 και το μεταλλαγμένο γονίδιο Ζ2 δίνει τον χαρακτήρα Ζ2.

Το παρακάτω σχήμα δείχνει την κωδική και μη κωδική αλυσίδα του φυσιολογικού γονιδίου Ζ και το φυσιολογικό πεπτίδιο που αυτό κωδικοποιεί:

ΦΥΣΙΟΛΟΓΙΚΟ ΓΟΝΙΔΙΟ Ζ:

ΑΤATAATTTAGTGGTACCGCCCCCCCCAGCCCGGGGTAAAA
TATATTAAATCACCATGGCGGGGGGGGTCGGGCCCCATTTT

ΦΥΣΙΟΛΟΓΙΚΟ ΠΕΠΤΙΔΙΟ Ζ:

ΝΗ2- met- gly- pro-glu-pro-trp- COOH

Επίσης δίνονται οι δύο μεταλλαγμένες πρωτεΐνες (Ζ1-Ζ2):

ΜΕΤΑΛΛΑΓΜΕΝΗ ΠΡΩΤΕΙΝΗ Ζ1:

NH2- met-gly- arg-ser-glu-pro-trp-COOH

ΜΕΤΑΛΛΑΓΜΕΝΗ ΠΡΩΤΕΙΝΗ Ζ2:

NH2- met-gly-pro-COOH

Υποδείξτε ένα πιθανό μηχανισμό μετάλλαξης για καθένα από τα δύο παραπάνω μεταλλαγμένα γονίδια Ζ1 και Ζ2. Kαι στις δύο μεταλλάξεις το μήκος της πολυνουκλεοτιδικής αλυσίδας έχει αλλάξει.

Δίνονται: GGGàgly, CCC, CCAà pro, GAGàglu, CGAàarg, UCCà ser, UGGàtrp


Γ3) Τα δύο μεταλλαγμένα γονίδια είναι υπολειπόμενα σε σχέση με το επικρατές φυσιολογικό γονίδιο Ζ ενώ μεταξύ τους έχουν σχέση συνεπικράτειας (Ζ1=Ζ2)<Ζ.

Πως ονομάζονται οι διαφορετικές μορφές – παραλλαγές του φυσιολογικού γονιδίου και εξηγήστε γιατί σε αυτές τις περιπτώσεις δεν ισχύουν οι αναλογίες του 1ου νόμου του Mendel;

Πόσοι διαφορετικοί γονότυποι και φαινότυποι για τον συγκεκριμένο χαρακτήρα υπάρχουν στο είδος Μ;               

Γ4) Ποιοι οι πιθανοί γαμέτες ενός ατόμου του είδους Μ που δεν έχει χρωμοσωμική ανωμαλία και έχει φαινότυπο Ζ1Ζ2 αν:
-Δεν γίνει σωστός διαχωρισμός του 18ου ζεύγους ομολόγων χρωμοσωμάτων στην 1η μείωση;
-Δεν γίνει σωστός διαχωρισμός των αδελφών χρωματίδων του ενός εκ των δυο 18ου χρωμοσωμάτων στην 2η μείωση;


PKU και αλφισμός

Εικόνα 6.4

Εικόνα 6.4 σχολικού βιβλίου: Διάγραμμα στο οποίο φαίνονται τα σημεία όπου υπάρχει «εμπόδιο» που διακόπτει το μεταβολισμό της φαινυλαλανίνης προς μελανίνη στη φαινυλκετονουρία (1) και στον αλφισμό (2). Το εμπόδιο δημιουργείται από έλλειψη των αντιστοίχων ενζύμων που προκαλείται από μεταλλάξεις στα γονίδια που τα κωδικοποιούν.